Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
SNORD48HUMAN NR_002745SR-19004
miR-126HUMAN, RAT, MOUSEucguaccgugaguaauaaugcg SM-10056
miR-126 ControlSMC-10056
miR-19aHUMAN, RAT, MOUSEugugcaaaucuaugcaaaacuga SM-10065
miR-19a ControlSMC-10065
miR-134HUMAN, RAT, MOUSEugugacugguugaccagagggg SM-10133
miR-134 ControlSMC-10133
miR-146aHUMAN, RAT, MOUSEugagaacugaauuccauggguu SM-10005
miR-146a ControlSMC-10005
miR-150HUMAN, RAT, MOUSEucucccaacccuuguaccagug SM-10108
miR-150 ControlSMC-10108
miR-184HUMAN, RAT, MOUSEuggacggagaacugauaagggu SM-10060
miR-184 ControlSMC-10060
miR-19bHUMAN, RAT, MOUSEugugcaaauccaugcaaaacuga SM-10066
miR-19b ControlSMC-10066
miR-185HUMAN, RAT, MOUSEuggagagaaaggcaguuccuga SM-10138
miR-185 ControlSMC-10138
miR-186HUMAN, RAT, MOUSEcaaagaauucuccuuuugggcu SM-10114
miR-186 ControlSMC-10114
miR-193a-5pHUMANugggucuuugcgggcgagauga SM-10112
miR-193a-5p ControlSMC-10112
miR-193a-3pHUMAN, RAT, MOUSEaacuggccuacaaagucccagu SM-10129
miR-193a-3p ControlSMC-10129
miR-194HUMAN, RAT, MOUSEuguaacagcaacuccaugugga SM-10096
miR-194 ControlSMC-10096
miR-195HUMAN, RAT, MOUSEuagcagcacagaaauauuggc SM-10014
miR-195 ControlSMC-10014
miR-206HUMAN, RAT, MOUSEuggaauguaaggaagugugugg SM-10034
miR-206 ControlSMC-10034
miR-20aHUMAN, RAT, MOUSEuaaagugcuuauagugcagguag SM-10047
miR-20a ControlSMC-10047
miR-200cHUMAN, MOUSEuaauacugccggguaaugaugga SM-10080
miR-200c ControlSMC-10080
miR-155HUMANuuaaugcuaaucgugauaggggu SM-10003
miR-155 ControlSMC-10003
miR-106bHUMAN, RAT, MOUSEuaaagugcugacagugcagau SM-10072
miR-106b ControlSMC-10072
miR-29cHUMAN, RAT, MOUSEuagcaccauuugaaaucgguua SM-10050
miR-29c ControlSMC-10050