Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-338-3pHUMAN, MOUSEuccagcaucagugauuuuguug SM-10200
miR-338-3p ControlSMC-10200
miR-490-5pHUMAN, RAT, MOUSEccauggaucuccaggugggu SM-10193
miR-490-5p ControlSMC-10193
miR-490-3pHUMAN, RAT, MOUSE, MOUSEcaaccuggaggacuccaugcug SM-10194
miR-490-3p ControlSMC-10194
miR-574-3pHUMAN, MOUSEcacgcucaugcacacacccaca SM-10195
miR-574-3p ControlSMC-10195
miR-708HUMAN, RAT, MOUSEaaggagcuuacaaucuagcuggg SM-10201
miR-708 ControlSMC-10201
miR-301bHUMANcagugcaaugauauugucaaagc SM-10199
miR-301b ControlSMC-10199
miR-127-5pHUMAN, MOUSEcugaagcucagagggcucugau SM-10202
miR-127-5p ControlSMC-10202
miR-127-3pHUMAN, RAT, MOUSEucggauccgucugagcuuggcu SM-10203
miR-127-3p ControlSMC-10203
miR-425HUMAN, RAT, MOUSEaaugacacgaucacucccguuga SM-10204
miR-425 ControlSMC-10204
miR-660HUMANuacccauugcauaucggaguug SM-10205
miR-660 ControlSMC-10205
miR-744*HUMAN, MOUSEcuguugccacuaaccucaaccu SM-10207
miR-744* ControlSMC-10207
miR-323-5pHUMAN, RAT, MOUSEaggugguccguggcgcguucgc SM-10208
miR-323-5p ControlSMC-10208
U14ZEA MAYS Z35298SR-19008
miR-744HUMAN, MOUSEugcggggcuagggcuaacagca SM-10206
miR-744 ControlSMC-10206
miR-155RAT, MOUSEuuaaugcuaauugugauaggggu SM-10209
miR-155 ControlSMC-10209
miR-326RAT, MOUSEccucugggcccuuccuccagu SM-10210
miR-326 ControlSMC-10210
miR-374cHUMANauaauacaaccugcuaagugcu SM-10222
miR-374c ControlSMC-10222
miR-374aHUMANuuauaauacaaccugauaagug SM-10220
miR-374a ControlSMC-10220
miR-382HUMAN, RAT, MOUSEgaaguuguucgugguggauucg SM-10267
miR-382 ControlSMC-10267
miR-374-3pMOUSEgguuguauuaucauuguccgag SM-10225
miR-374-3p ControlSMC-10225