Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-453HUMAN, HUMANagguuguccguggugaguucgca SM-10216
miR-453 ControlSMC-10216
miR-517aHUMANaucgugcaucccuuuagagugu SM-10217
miR-517a ControlSMC-10217
miR-517bHUMANucgugcaucccuuuagaguguu SM-10219
miR-517b ControlSMC-10219
miR-517cHUMANaucgugcauccuuuuagagugu SM-10218
miR-517c ControlSMC-10218
miR-589HUMANugagaaccacgucugcucugag SM-10269
miR-589 ControlSMC-10269
miR-636HUMANugugcuugcucgucccgcccgca SM-10268
miR-636 ControlSMC-10268
miR-374bHUMAN, RAT, MOUSEauauaauacaaccugcuaagug SM-10221
miR-374b ControlSMC-10221
miR-513cHUMANuucucaaggaggugucguuuau SM-10270
miR-513c ControlSMC-10270
miR-212RAT, MOUSE, MOUSEuaacagucuccagucacggcca SM-10223
miR-212 ControlSMC-10223
miR-215RAT, MOUSEaugaccuaugauuugacagac SM-10224
miR-215 ControlSMC-10224
miR-449bMOUSEaggcaguguuguuagcuggc SM-10226
miR-449b ControlSMC-10226
miR-466kMOUSEuguguguguacauguacauguga SM-10227
miR-466k ControlSMC-10227
miR-592HUMANuugugucaauaugcgaugaugu SM-10275
miR-592 ControlSMC-10275
miR-758HUMAN, RATuuugugaccugguccacuaacc SM-10276
miR-758 ControlSMC-10276
miR-687MOUSEcuauccuggaaugcagcaauga SM-10277
miR-687 ControlSMC-10277
miR-675-5pRAT, MOUSEuggugcggaaagggcccacagu SM-10278
miR-675-5p ControlSMC-10278
miR-224MOUSE, MOUSEuaagucacuagugguuccguu SM-10279
miR-224 ControlSMC-10279
miR-140-5pHUMAN, RAT, MOUSEcagugguuuuacccuaugguag SM-10280
miR-140-5p ControlSMC-10280
miR-514b-3pHUMAN, HUMANauugacaccucugugagugga SM-10281
miR-514b-3p ControlSMC-10281
miR-299-5pHUMAN, RAT, MOUSEugguuuaccgucccacauacau SM-10282
miR-299-5p ControlSMC-10282