Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
SNORA25HUMAN ENSG00000252290SM-10328
HBII-438AHUMAN HBII-438ASM-10329
miR-223*HUMANcguguauuugacaagcugaguu SM-10330
miR-223* ControlSMC-10330
miR-3680HUMAN, HUMANgacucacucacaggauugugca SM-10331
miR-3680 ControlSMC-10331
miR-202-5pRAT, MOUSEuuccuaugcauauacuucuuu SM-10332
miR-202-5p ControlSMC-10332
miR-741-3pRATaaagaugccacgcuauguagau SM-10333
miR-741-3p ControlSMC-10333
miR-885-5pHUMANuccauuacacuacccugccucu SM-10334
miR-885-5p ControlSMC-10334
miR-548nHUMANcaaaaguaauuguggauuuugu SM-10335
miR-548n ControlSMC-10335
miR-923HUMANgucagcggaggaaaagaaacu SM-10337
miR-923 ControlSMC-10337
miR-1293HUMANuggguggucuggagauuugugc SM-10340
miR-1293 ControlSMC-10340
miR-588HUMANuuggccacaauggguuagaac SM-10341
miR-588 ControlSMC-10341
miR-4440HUMANugucguggggcuugcuggcuug SM-10343
miR-4440 ControlSMC-10343
miR-324-3pHUMANacugccccaggugcugcugg SM-10344
miR-324-3p ControlSMC-10344
miR-1303HUMANuuuagagacggggucuugcucu SM-10345
miR-1303 ControlSMC-10345
miR-378bHUMANacuggacuuggaggcagaa SM-10353
miR-378b ControlSMC-10353
miR-216aHUMAN, RAT, MOUSEuaaucucagcuggcaacuguga SM-10354
miR-216a ControlSMC-10354
miR-216bHUMAN, RAT, MOUSEaaaucucugcaggcaaauguga SM-10355
miR-216b ControlSMC-10355
miR-1275HUMANgugggggagaggcuguc SM-10356
miR-1275 ControlSMC-10356
miR-505*HUMANgggagccaggaaguauugaugu SM-10379
miR-505* ControlSMC-10379
let-7c*HUMANuagaguuacacccugggaguua SM-10380
let-7c* ControlSMC-10380