Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-145MACACA MULATTAguccaguuuucccaggaaucccuu SM-10498
miR-145 ControlSMC-10498
miR-39-3pwormucaccggguguaaaucagcuug SM-10509
miR-39-3p ControlSMC-10509
miR-238-5pwormuggauguucucggacguucaaagc SM-10510
miR-238-5p ControlSMC-10510
miR-1974HUMANugguuguaguccgugcgagaaua SM-10531
miR-1974 ControlSMC-10531
miR-223RATugucaguuugucaaauacccc SM-10532
miR-223 ControlSMC-10532
miR-181a*HUMAN, RAT, MOUSEaccaucgaccguugauuguacc SM-10535
miR-181a* ControlSMC-10535
miR-337-3pHUMANcuccuauaugaugccuuucuuc SM-10536
miR-337-3p ControlSMC-10536
miR-491-5pHUMAN, MOUSEaguggggaacccuuccaugagg SM-10537
miR-491-5p ControlSMC-10537
miR-18a*HUMANacugcccuaagugcuccuucugg SM-10538
miR-18a* ControlSMC-10538
miR-192*HUMAN, MOUSEcugccaauuccauaggucacag SM-10539
miR-192* ControlSMC-10539
miR-183*HUMAN, MOUSEgugaauuaccgaagggccauaa SM-10540
miR-183* ControlSMC-10540
miR-200b*HUMAN, RAT, MOUSEcaucuuacugggcagcauugga SM-10541
miR-200b* ControlSMC-10541
miR-194*HUMAN, MOUSEccaguggggcugcuguuaucug SM-10542
miR-194* ControlSMC-10542
miR-1236HUMANccucuuccccuugucucuccag SM-10543
miR-1236 ControlSMC-10543
miR-1323HUMANucaaaacugaggggcauuuucu SM-10544
miR-1323 ControlSMC-10544
miR-1250HUMANacggugcuggauguggccuuu SM-10545
miR-1250 ControlSMC-10545
miR-4257HUMANccagagguggggacugag SM-10546
miR-4257 ControlSMC-10546
miR-3613-3pHUMANacaaaaaaaaaagcccaacccuuc SM-10547
miR-3613-3p ControlSMC-10547
miR-4700-5pHUMANucuggggaugaggacagugugu SM-10548
miR-4700-5p ControlSMC-10548
miR-4433-5pHUMANcgucccaccccccacuccugu SM-10549
miR-4433-5p ControlSMC-10549