Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-200aHUMAN, RAT, MOUSEuaacacugucugguaacgaugu SM-10078
miR-200a ControlSMC-10078
miR-302aHUMAN, MOUSEuaagugcuuccauguuuugguga SM-10145
miR-302a ControlSMC-10145
miR-34bHUMANcaaucacuaacuccacugccau SM-10019
miR-34b ControlSMC-10019
miR-21HUMAN, RAT, MOUSEuagcuuaucagacugauguuga SM-10031
miR-21 ControlSMC-10031
miR-99bHUMAN, RAT, MOUSEcacccguagaaccgaccuugcg SM-10135
miR-99b ControlSMC-10135
miR-130bHUMAN, RAT, MOUSEcagugcaaugaugaaagggcau SM-10073
miR-130b ControlSMC-10073
miR-30eHUMAN, RAT, MOUSEuguaaacauccuugacuggaag SM-10083
miR-30e ControlSMC-10083
miR-22HUMAN, RAT, MOUSEaagcugccaguugaagaacugu SM-10086
miR-22 ControlSMC-10086
miR-363HUMAN, RAT, MOUSE, MOUSEaauugcacgguauccaucugua SM-10148
miR-363 ControlSMC-10148
miR-302bHUMAN, MOUSEuaagugcuuccauguuuuaguag SM-10166
miR-302b ControlSMC-10166
miR-302dHUMAN, MOUSEuaagugcuuccauguuugagugu SM-10146
miR-302d ControlSMC-10146
miR-367HUMAN, MOUSEaauugcacuuuagcaaugguga SM-10149
miR-367 ControlSMC-10149
miR-23aHUMAN, RAT, MOUSEaucacauugccagggauuucc SM-10067
miR-23a ControlSMC-10067
miR-370HUMAN, MOUSEgccugcugggguggaaccuggu SM-10150
miR-370 ControlSMC-10150
miR-372HUMANaaagugcugcgacauuugagcgu SM-10098
miR-372 ControlSMC-10098
miR-373HUMANgaagugcuucgauuuuggggugu SM-10109
miR-373 ControlSMC-10109
miR-375HUMAN, RAT, MOUSEuuuguucguucggcucgcguga SM-10089
miR-375 ControlSMC-10089
miR-376aHUMANaucauagaggaaaauccacgu SM-10167
miR-376a ControlSMC-10167
miR-24HUMAN, RAT, MOUSEuggcucaguucagcaggaacag SM-10088
miR-24 ControlSMC-10088
miR-377HUMAN, MOUSEaucacacaaaggcaacuuuugu SM-10161
miR-377 ControlSMC-10161