Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-378HUMAN, RAT, MOUSEacuggacuuggagucagaagg SM-10087
miR-378 ControlSMC-10087
miR-25HUMAN, RAT, MOUSEcauugcacuugucucggucuga SM-10094
miR-25 ControlSMC-10094
miR-326HUMANccucugggcccuuccuccag SM-10102
miR-326 ControlSMC-10102
miR-151-5pHUMAN, RAT, MOUSEucgaggagcucacagucuagu SM-10171
miR-151-5p ControlSMC-10171
miR-151-3pHUMANcuagacugaagcuccuugagg SM-10164
miR-151-3p ControlSMC-10164
let-7aHUMAN, RAT, MOUSE, wormugagguaguagguuguauaguu SM-10008
let-7a ControlSMC-10008
miR-26aHUMAN, RAT, MOUSEuucaaguaauccaggauaggcu SM-10069
miR-26a ControlSMC-10069
miR-135bHUMAN, RAT, MOUSEuauggcuuuucauuccuauguga SM-10075
miR-135b ControlSMC-10075
miR-148bHUMAN, RAT, MOUSEucagugcaucacagaacuuugu SM-10100
miR-148b ControlSMC-10100
miR-26bHUMAN, RAT, MOUSEuucaaguaauucaggauaggu SM-10179
miR-26b ControlSMC-10179
miR-133bHUMAN, RAT, MOUSEuuugguccccuucaaccagcua SM-10175
miR-133b ControlSMC-10175
miR-346HUMANugucugcccgcaugccugccucu SM-10147
miR-346 ControlSMC-10147
miR-196bHUMAN, RAT, MOUSEuagguaguuuccuguuguuggg SM-10077
miR-196b ControlSMC-10077
miR-18bHUMANuaaggugcaucuagugcaguuag SM-10104
miR-18b ControlSMC-10104
miR-20bHUMAN, MOUSEcaaagugcucauagugcagguag SM-10048
miR-20b ControlSMC-10048
miR-429HUMANuaauacugucugguaaaaccgu SM-10110
miR-429 ControlSMC-10110
miR-449aHUMAN, RAT, MOUSEuggcaguguauuguuagcuggu SM-10118
miR-449a ControlSMC-10118
miR-433HUMAN, RAT, MOUSEaucaugaugggcuccucggugu SM-10090
miR-433 ControlSMC-10090
miR-376bHUMANaucauagaggaaaauccauguu SM-10151
miR-376b ControlSMC-10151
DapBHUMANcagaacgaacaccacauuuugac SM-10180
DapB ControlSMC-10180