Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-499-5pHUMAN, RAT, MOUSEuuaagacuugcagugauguuu SM-10041
miR-499-5p ControlSMC-10041
miR-500HUMAN, HUMANuaauccuugcuaccugggugaga SM-10122
miR-500 ControlSMC-10122
miR-503HUMANuagcagcgggaacaguucugcag SM-10154
miR-503 ControlSMC-10154
miR-504HUMAN, MOUSEagacccuggucugcacucuauc SM-10153
miR-504 ControlSMC-10153
miR-96HUMAN, RAT, MOUSEuuuggcacuagcacauuuuugcu SM-10054
miR-96 ControlSMC-10054
miR-532-5pHUMAN, MOUSEcaugccuugaguguaggaccgu SM-10172
miR-532-5p ControlSMC-10172
miR-92bHUMAN, RAT, MOUSEuauugcacucgucccggccucc SM-10117
miR-92b ControlSMC-10117
miR-99aHUMAN, RAT, MOUSEaacccguagauccgaucuugug SM-10134
miR-99a ControlSMC-10134
miR-558HUMANugagcugcuguaccaaaau SM-10017
miR-558 ControlSMC-10017
miR-100HUMAN, RAT, MOUSEaacccguagauccgaacuugug SM-10095
miR-100 ControlSMC-10095
miR-101HUMAN, RAT, MOUSEuacaguacugugauaacugaa SM-10055
miR-101 ControlSMC-10055
miR-584HUMANuuaugguuugccugggacugag SM-10156
miR-584 ControlSMC-10156
miR-103HUMAN, RAT, MOUSEagcagcauuguacagggcuauga SM-10101
miR-103 ControlSMC-10101
let-7cHUMAN, RAT, MOUSEugagguaguagguuguaugguu SM-10010
let-7c ControlSMC-10010
miR-105HUMANucaaaugcucagacuccuguggu SM-10043
miR-105 ControlSMC-10043
miR-601HUMANuggucuaggauuguuggaggag SM-10157
miR-601 ControlSMC-10157
miR-106aHUMANaaaagugcuuacagugcagguag SM-10071
miR-106a ControlSMC-10071
miR-107HUMAN, RAT, MOUSEagcagcauuguacagggcuauca SM-10001
miR-107 ControlSMC-10001
miR-192HUMAN, RAT, MOUSEcugaccuaugaauugacagcc SM-10062
miR-192 ControlSMC-10062
miR-33bHUMANgugcauugcuguugcauugc SM-10182
miR-33b ControlSMC-10182